BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K115017 1 BBa_K115017 RNA thermometer (ROSE 32??C) 2008-08-19T11:00:00Z 2015-05-08T01:09:28Z Based on ROSE RNA thermometer sequences from Rfam database. Released HQ 2013 An RNA thermometer that theoretically switches on translation at 32 degrees Celcius and switched of translation below that temperature. Still to be tested. false false _223_ 0 3006 9 In stock true a lot, will be added soon. true Bastiaan van den Berg annotation1972920 1 SD range1972920 1 77 82 BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K235036 1 BBa_K235036 [K235030][K235005] (constituitive promoter+32??C RBS thermometer+mCherry CDS+stop) 2009-10-19T11:00:00Z 2015-05-08T01:11:36Z [K235030][K235005] This part should have been a temperature sensitive RFP generator, that would be restricted above 32??C. However, this part was not debugged in time for the 2009 competition. false false _336_ 0 5572 9 Not in stock false None. false Natasha Tuskovich component2055215 1 BBa_B0010 component2055209 1 BBa_J23102 component2055211 1 BBa_K115017 component2055214 1 BBa_J06504 component2055217 1 BBa_B0012 annotation2055215 1 BBa_B0010 range2055215 1 855 934 annotation2055211 1 BBa_K115017 range2055211 1 44 126 annotation2055217 1 BBa_B0012 range2055217 1 943 983 annotation2055214 1 BBa_J06504 range2055214 1 133 846 annotation2055209 1 BBa_J23102 range2055209 1 1 35 BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585829 1 mCherry range1585829 1 1 711 annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K115017_sequence 1 ccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggat BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_K235036_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggattactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z