BBa_K237000 1 RIP RIP - Quorum sensing inhibitor of Staphylococcus spp. (Including MRSA) 2009-08-02T11:00:00Z 2015-05-08T01:11:36Z The RIP peptide is produced by coagulase negative staphylococcus (suggested to be S. warnerii or S. xylosus) (16,19) RIP or RNAIII inhibiting peptide is a heptapeptide capable of severely reducing the Qourum sensing(QS) abilities of Staphylococcus species. RIP effectively works as an antibiotic in its inhibition of bacterial growth. RIP has the sequence YSPXTNF and has been tested extensively in a synthetic (as in organic) form for ability to inhibit bacterial infections in mice. References will come later. This is a pure RIP Brick, it contains no signal sequence and we can at this point in our project not verify that it will be exported by our Coli's false false _333_ 0 4087 9 It's complicated true This sequence is reverse-engineered from the amino-acid sequence by using the commonly used codons of E. Coli. It is designed to provide a big output of peptide. We just hope that this output won't kill the cell. false Marc T. K. Nielsen annotation2014625 1 Stop range2014625 1 25 29 annotation2014626 1 YSPWTNF range2014626 1 4 24 annotation2014624 1 Start range2014624 1 1 3 BBa_K237000_sequence 1 atgtattctccgtggaccaacttttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z