BBa_K237000 1 RIP RIP - Quorum sensing inhibitor of Staphylococcus spp. (Including MRSA) 2009-08-02T11:00:00Z 2015-05-08T01:11:36Z The RIP peptide is produced by coagulase negative staphylococcus (suggested to be S. warnerii or S. xylosus) (16,19) RIP or RNAIII inhibiting peptide is a heptapeptide capable of severely reducing the Qourum sensing(QS) abilities of Staphylococcus species. RIP effectively works as an antibiotic in its inhibition of bacterial growth. RIP has the sequence YSPXTNF and has been tested extensively in a synthetic (as in organic) form for ability to inhibit bacterial infections in mice. References will come later. This is a pure RIP Brick, it contains no signal sequence and we can at this point in our project not verify that it will be exported by our Coli's false false _333_ 0 4087 9 It's complicated true This sequence is reverse-engineered from the amino-acid sequence by using the commonly used codons of E. Coli. It is designed to provide a big output of peptide. We just hope that this output won't kill the cell. false Marc T. K. Nielsen annotation2014625 1 Stop range2014625 1 25 29 annotation2014626 1 YSPWTNF range2014626 1 4 24 annotation2014624 1 Start range2014624 1 1 3 BBa_K237001 1 BBa_K237001 IPTG inducible RIP Generator. RIP - Quorum sensing inhibitor of Staphylococcus spp. 2009-08-02T11:00:00Z 2015-05-08T01:11:36Z The RIP peptide is produced by coagulase negative staphylococcus (suggested to be S. warnerii or S. xylosus). RIP or RNAIII inhibiting peptide is a heptapeptide capable of severely reducing the Qourum sensing(QS) abilities of Staphylococcus species. RIP effectively works as an antibiotic in its inhibition of bacterial growth. RIP has the sequence YSPXTNF and has been tested extensively in a synthetic (as in organic) form for ability to inhibit bacterial infections in mice. References will come later. false false _333_ 0 4087 9 Not in stock false There are 4 versions of RIP producers from us. 1 - Constitutively produced RIP without an export sequence 2 - Inducibly produced RIP without an export sequence 3 - Constitutively produced RIP with an export sequence (OmpA) 4 - Inducibly produced RIP with an export sequence (OmpA) This is number 2 false Marc T. K. Nielsen component2014644 1 BBa_K237000 component2014640 1 BBa_B0034 component2014645 1 BBa_B0010 component2014634 1 BBa_R0011 component2014647 1 BBa_B0012 annotation2014634 1 BBa_R0011 range2014634 1 1 54 annotation2014644 1 BBa_K237000 range2014644 1 82 111 annotation2014645 1 BBa_B0010 range2014645 1 120 199 annotation2014647 1 BBa_B0012 range2014647 1 208 248 annotation2014640 1 BBa_B0034 range2014640 1 64 75 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation2000 1 -35 range2000 1 20 25 annotation1999 1 lac O1 range1999 1 3 19 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K237001_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgtattctccgtggaccaacttttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_K237000_sequence 1 atgtattctccgtggaccaacttttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z