BBa_K237007 1 BBa_K237007 VR2 2009-10-20T11:00:00Z 2015-05-08T01:11:36Z VR with some small modifications We modified <partinfo>BBa_G00101</partinfo>(VR) to achieve a higher GC content, so that it might be more stable in PCR reactions. We have made sure that it matches at least plasmids psB1A2, psB1A3 and pSB1AK3. It likely fits with more, but we haven't checked. false false _333_ 0 4087 9 Not in stock true GC content, matching to multiple backbones. false Marc T. K. Nielsen annotation2058316 1 VR2 range2058316 1 1 20 BBa_K237007_sequence 1 attaccgcctttgagtgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z