BBa_K238001 1 BBa_K238001 VirB promoter and anti sense key 2009-07-14T11:00:00Z 2015-05-08T01:11:36Z parts are both found in the registry OmpF promoter regulated bij a vanilla sensing receptor and an anti sense key false false _332_ 0 4771 9 Not in stock true we used this specific key because of its succes. no RBS was needed. false Annelien Verfaillie component2220494 1 BBa_K238005 component2220501 1 BBa_B0015 component2220490 1 BBa_K238011 annotation2220490 1 BBa_K238011 range2220490 1 1 236 annotation2220501 1 BBa_B0015 range2220501 1 589 717 annotation2220494 1 BBa_K238005 range2220494 1 245 580 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K238005 1 antisense Anti sense key 2009-07-15T11:00:00Z 2015-05-08T01:11:36Z PCR on part J23066 the key part J23066 is inverted so that the anti sense version is transcribed. false false _332_ 0 4771 9 It's complicated true terminators need to be removed false Annelien Verfaillie annotation2011531 1 J23008 range2011531 1 106 199 annotation2011532 1 J23009 range2011532 1 1 97 annotation2027991 1 stop codons range2027991 1 200 336 BBa_K238011 1 VirB VirB promoter region 2009-07-27T11:00:00Z 2015-05-08T01:11:36Z Agrobacterium tumefaciens pTiBo542 and pTiA6NC/A1011 This is the region where the "vir box" can be found. VirG will bind here and stimulate the transcription of the genes that are downstream of this promoter. false false _332_ 0 4771 9 It's complicated true none false Annelien Verfaillie annotation2013828 1 transcription start range2013828 1 180 181 annotation2013531 1 rbs range2013531 1 231 236 annotation2013553 1 vir box range2013553 1 133 144 annotation2013829 1 pt -35 box range2013829 1 145 150 annotation2013530 1 vir box range2013530 1 113 124 annotation2013568 1 pt -10 box range2013568 1 167 173 annotation2013567 1 alt transcription start range2013567 1 182 183 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K238005_sequence 1 cgggcgggcgggcgggcgggaagctttttttttttaactagaatcacctcttgcttttgggttttttttttatggatcccgcccgcccgcccgcccgctctagtaaagccggattaataatctggctttttagagatatttctagtaagtaagttaattttcattaaccaccaactagaatcacctcttgcttttgggttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K238001_sequence 1 ttcgttctgaggccgacctgaccaactgcggtctgtcaatccggttgctttgtcagggatgcgcggttctcggtccatgttttgttccaagacgccgagcgaaggttttcgcttcaattgaaatcataaagaagcaattgaaaattttcgagtaaccgaccctcccgataatcgtcaacataaaacaacgcacttcttccaacgggagaggcggtgttagttgcgagctaaggagatactagagcgggcgggcgggcgggcgggaagctttttttttttaactagaatcacctcttgcttttgggttttttttttatggatcccgcccgcccgcccgcccgctctagtaaagccggattaataatctggctttttagagatatttctagtaagtaagttaattttcattaaccaccaactagaatcacctcttgcttttgggttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K238011_sequence 1 ttcgttctgaggccgacctgaccaactgcggtctgtcaatccggttgctttgtcagggatgcgcggttctcggtccatgttttgttccaagacgccgagcgaaggttttcgcttcaattgaaatcataaagaagcaattgaaaattttcgagtaaccgaccctcccgataatcgtcaacataaaacaacgcacttcttccaacgggagaggcggtgttagttgcgagctaaggaga BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z