BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23008 1 BBa_J23008 [key3c] riboregulator for lock3 variants 2006-07-09T11:00:00Z 2015-08-31T04:08:38Z J23007 This part has the same homology region to J01122 as J23007 except that unlike J23007, J23008 does not contain the hairpin that was derived from J01129. J23008 anneals linearly to the stem of the hairpin in J01122 with perfect base pairing and destroys the hairpin in the process and reveals the RBS on J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. When J23008 is introduced into the cell in trans, we suspect that it will unlock the RBS for RFP as described above allowing translation to occur. false false _52_ 0 931 52 In stock false No design considerations true Kaitlin Davis BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K238002 1 BBa_K238002 Blue light promoter and key 2009-07-14T11:00:00Z 2015-05-08T01:11:36Z PCR-ing of a sequence to get the promoter key is from the registry the promoter is regulated by the ycgF/E system which is a blue light responsive receptor/repressor false false _332_ 0 4771 9 Not in stock true restriction sites in the sequence needed to be checked. false Annelien Verfaillie component2029787 1 BBa_B0012 component2029783 1 BBa_J23008 component2029785 1 BBa_B0010 component2029784 1 BBa_J23009 component2029782 1 BBa_K238013 annotation2029782 1 BBa_K238013 range2029782 1 1 86 annotation2029787 1 BBa_B0012 range2029787 1 390 430 annotation2029785 1 BBa_B0010 range2029785 1 302 381 annotation2029783 1 BBa_J23008 range2029783 1 95 188 annotation2029784 1 BBa_J23009 range2029784 1 197 293 BBa_J23009 1 BBa_J23009 [key3d] riboregulator for lock3 variants 2006-08-02T11:00:00Z 2015-08-31T04:08:38Z Overlap extension Variant of key3 (see part J01129 (key3), J23007(key3b), J23008(key3c)). Part is in pJ23006, so there is a Ptet upstream of the XbaI site to drive expression. Nevertheless, J23009 is still a basic part allowing both prefix and suffix insertions. false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_K238013 1 BLp Exact promoter of the blue light receptor 2009-08-01T11:00:00Z 2015-05-08T01:11:36Z E.coli strain MC4100 ycgF/E regulated promoter region ycgf is a cytoplasmic receptor which responds to blue light. it contains a Blue light Using FAD-Domain (BLUF) and an EAL domain. when blue light strikes, the receptor changes conformation and dimerizes. This allows it to bind to ycgE repressor through its EAL-domain releasing the repressor from this promoter region. See reference for more info: Natalia Tschowri, Susan Busse and Regine Hengge, The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli. Genes and development23: 522-534 (2009) false false _332_ 0 4771 9 It's complicated true none false Annelien Verfaillie annotation2014612 1 inverted repeat part 1 range2014612 1 53 59 annotation2014614 1 transcription start range2014614 1 64 65 annotation2014610 1 -10 box range2014610 1 52 58 annotation2014609 1 -35 box range2014609 1 28 33 annotation2014613 1 inverted repeat part 2 range2014613 1 67 73 annotation2014611 1 spacer range2014611 1 34 51 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23008_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_K238013_sequence 1 attgcaaaaaattaatttatcattctgtacacatatttcgtacaagtttgctattgttacttcacttaacattgattaacattttt BBa_J23009_sequence 1 cgggcgggcgggcgggcgggatccataaaaaaaaaacccaaaagcaagaggtgattctagttaaaaaaaaaaagcttcccgcccgcccgcccgcccg BBa_K238002_sequence 1 attgcaaaaaattaatttatcattctgtacacatatttcgtacaagtttgctattgttacttcacttaacattgattaacattttttactagagacccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagcgggcgggcgggcgggcgggatccataaaaaaaaaacccaaaagcaagaggtgattctagttaaaaaaaaaaagcttcccgcccgcccgcccgcccgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z