BBa_K238024 1 BBa_K238024 lock 2009-09-26T11:00:00Z 2015-05-08T01:11:36Z none this is the lock in the key-lock system. This device was originally designed by John Anderson of berkeley iGEM team 2006. however, the DNA was inconsistened after sequencing so we let Geneart make the proper sequence for us. false false _332_ 0 4771 9 It's complicated true none false Annelien Verfaillie annotation2030050 1 lock range2030050 1 1 52 BBa_K238024_sequence 1 tgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z