BBa_K238028 1 BBa_K238028 ech with RBS 2009-10-05T11:00:00Z 2015-05-08T01:11:36Z provided by the Chris French lab from the university of Edinburgh. this is one of the enzymes needed to transform tyrosin in vanillin. the original part had number I742113 false false _332_ 0 4771 9 It's complicated true none false Annelien Verfaillie component2028789 1 BBa_I742112 component2028785 1 BBa_J15001 annotation2028789 1 BBa_I742112 range2028789 1 17 850 annotation2028785 1 BBa_J15001 range2028785 1 1 10 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938046 1 rbs range1938046 1 4 10 annotation1938045 1 SacI range1938045 1 1 3 BBa_I742112 1 BBa_I742112 enoyl CoA hydratase (ech) gene 2007-10-18T11:00:00Z 2015-08-31T04:08:02Z Pseudomonas fluorescens NCIMB 9046 Cloning and Characterization of the Ferulic Acid Catabolic Genes of Sphingomonas paucimobilis SYK-6, E Masai, et al, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 68(9): 4416???4424 (2002) enoyl CoA hydratase (ech) was isolated from Pseudomonas fluorescens genome. Ech converts feruloyl CoA to vanillin (fig. 3) and catalyses the final stage of the vanillin biosynthesis pathway. Involved in the synthesis of 'natural' vanilla flavouring false false _123_ 0 1964 9 Not in stock false Gene was synthesised by geneart as we experienced problems isolating native gene, due to the high GC nature of the Pseudomonas genome. The ech sequence has been optimised for expression in E. coli false sarah hollingshead annotation1949783 1 start range1949783 1 1 3 annotation1949784 1 stop range1949784 1 829 834 annotation1949782 1 ech coding region range1949782 1 1 828 BBa_K238028_sequence 1 ctcaaggaggtactagatgagcaaatatgaaggccgttggaccaccgtgaaagtggaaattgaagaaggcattgcctgggttattctgaaccgtccggaaaaacgtaacgccatgagcccgaccctgaaccgtgaaatgattgatgtgctggaaaccctggaacaggatccggcggcgggtgttctggttctgaccggtgcgggtgaagcgtggaccgcgggcatggatctgaaagaatatttccgtgaagtggatgcgggtccggaaattctgcaagaaaaaattcgtcgcgaagcgagccagtggcagtggaaactgctgcgtatgtatgcgaaaccgaccattgccatggtgaacggctggtgctttggcggcggttttagcccgctggttgcgtgcgatctggccatttgcgcggatgaagcgacctttggcctgagcgagattaactggggcattccgccgggtaacctggtgagcaaagccatggcggataccgtgggccatcgtcagagcctgtattatatcatgaccggcaaaacctttggtggccagaaagcggcggaaatgggcctggtgaacgaaagcgtgccgctggcccagctgcgtgaagtgaccattgaactggcccgtaacctgctggaaaaaaatccggtggtgctgcgtgcggcgaaacatggctttaaacgttgccgtgaactgacctgggaacagaacgaagattatctgtacgcgaaactggatcagagccgtctgctggataccgaaggcggccgtgaacagggcatgaaacagtttctggatgataaaagcattaaaccgggcctgcaagcgtataaacgttaataa BBa_I742112_sequence 1 atgagcaaatatgaaggccgttggaccaccgtgaaagtggaaattgaagaaggcattgcctgggttattctgaaccgtccggaaaaacgtaacgccatgagcccgaccctgaaccgtgaaatgattgatgtgctggaaaccctggaacaggatccggcggcgggtgttctggttctgaccggtgcgggtgaagcgtggaccgcgggcatggatctgaaagaatatttccgtgaagtggatgcgggtccggaaattctgcaagaaaaaattcgtcgcgaagcgagccagtggcagtggaaactgctgcgtatgtatgcgaaaccgaccattgccatggtgaacggctggtgctttggcggcggttttagcccgctggttgcgtgcgatctggccatttgcgcggatgaagcgacctttggcctgagcgagattaactggggcattccgccgggtaacctggtgagcaaagccatggcggataccgtgggccatcgtcagagcctgtattatatcatgaccggcaaaacctttggtggccagaaagcggcggaaatgggcctggtgaacgaaagcgtgccgctggcccagctgcgtgaagtgaccattgaactggcccgtaacctgctggaaaaaaatccggtggtgctgcgtgcggcgaaacatggctttaaacgttgccgtgaactgacctgggaacagaacgaagattatctgtacgcgaaactggatcagagccgtctgctggataccgaaggcggccgtgaacagggcatgaaacagtttctggatgataaaagcattaaaccgggcctgcaagcgtataaacgttaataa BBa_J15001_sequence 1 ctcaaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z