BBa_K239001 1 BBa_K239001 Spy promoter, activated by Phosporylated CpxR, BaeR and Sigma70 2009-06-21T11:00:00Z 2015-05-08T01:11:36Z Genomic sequence from biocyc, Escherichia coli K-12. Native unmodified sequence. Sequence contains 2 phosphorylated BaeR binding sites, 1 phosphorylated CpxR binding site and transcription is initiated by sigma factor 70. Function: Can detect various periplasmic stresses. Area of application: Hopefully it can be used to detect presence of relevant unfolded proteins in the periplasmic space, to detect shear stress or other so far undefined relevant stress. false false _375_ 0 4247 9 It's complicated true Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the first BaeR binding site and ends 5 pb after the -10 box. false Axel Nystrom annotation2006307 1 BaeR range2006307 1 4 22 annotation2006309 1 CpxR range2006309 1 107 120 annotation2006305 1 -10 range2006305 1 150 157 annotation2006306 1 -35 range2006306 1 128 136 annotation2006308 1 BaeR range2006308 1 66 81 BBa_K239001_sequence 1 agttcttcataatctctgcaaaatcatcgtgttgtaatattctctcatcactctccatcaaattttctttttttctccataattggcgcaaaagtgttttttacactttcattgttttaccgttgctctgattaattgacgctaaagtcagtaaagttaatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z