BBa_K239002 1 BBa_K239002 HypB promoter, activated by Fnr during oxygen deficiency 2009-06-21T11:00:00Z 2015-05-08T01:11:36Z Genomic sequence from biocyc, Escherichia coli K-12. Native unmodified sequence. Sequence contains 2 Fnr binding sites but no specific promoter sequence. Function: Switched on during anaerobic conditions. Area of application: Detection of when the cell is switching to anaerobic conditions. false false _375_ 0 4247 9 Not in stock false Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the first Fnr binding site and ends 37 pb after second Fnr binding site. false Axel Nystrom annotation2006794 1 -10 range2006794 1 147 152 annotation2006380 1 Fnr range2006380 1 110 123 annotation2006379 1 Fnr range2006379 1 4 17 BBa_K239002_sequence 1 gaattgatcgaacagcaggccgcaaaacacggcgcaaaacgcgtaactggggtctggctcaaaattggcgcattttcttgtgtcgaaaccagctctcttgccttttgttttgatctggtttgccgcggcagcgtggcggaaggttgtaaactgcacctcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z