BBa_K239003 1 BBa_K239003 Modified HypB promoter, activated by Fnr during oxygen deficiency 2009-06-21T11:00:00Z 2015-05-08T01:11:36Z Raw genomic sequence from biocyc, Escherichia coli K-12, but modified. Sequence contains 2 Fnr binding sites but no specific promoter sequence. Function: Switched on during anaerobic conditions. Area of application: Detection of when the cell is switching to anaerobic metabolism. false false _375_ 0 4247 9 Not in stock false Optimisation of Fnr binding sites, modification of position 2 bp. Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the first Fnr binding site and ends 35 bp after second Fnr binding site. false Axel Nystrom annotation2006684 1 Fnr range2006684 1 110 123 annotation2006683 1 Fnr range2006683 1 4 17 BBa_K239003_sequence 1 gaattgatcgaaatcaaggccgcaaaacacggcgcaaaacgcgtaactggggtctggctcaaaattggcgcattttcttgtgtcgaaaccagctctcttgccttttgttttgatctggatcaacggcagcgtggcggaaggttgtaaactgcacctcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z