BBa_K239004 1 BBa_K239004 Part of narGP promoter, activated by Fnr during oxygen deficiency 2009-06-25T11:00:00Z 2015-05-08T01:11:36Z Genomic sequence from biocyc, Escherichia coli K-12. Native unmodified sequence. Sequence contains 1 Fnr binding site, the specific promoter sequence is not determined yet, but it is transcribed by RNAP sigma factor 70. Function: Switched on during anaerobic conditions. Area of application: Detection of when the cell is switching to anaerobic conditions. false false _375_ 0 4247 9 Not in stock false Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the the Fnr binding site and ends 35 pb after the Fnr binding site. false Axel Nystrom annotation2006703 1 Fnr range2006703 1 4 17 BBa_K239004_sequence 1 ctcttgatcgttatcaattcccacgctgtttcagagcgttaccttgccctta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z