BBa_K239005 1 BBa_K239005 NarK promoter, Fnr activated under anaerobic conditions 2009-06-25T11:00:00Z 2015-05-08T01:11:36Z Genomic sequence from biocyc, Escherichia coli K-12. Native unmodified sequence. Sequence contains 2 Fnr, 1 Fis, 4 NarL and 1 IHF binding sites and initiates transcription by RNAP sigma-70. Function: Switched on during anaerobic conditions (upregulated 100-fold). Area of application: Detection of when the cell is switching to anaerobic metabolism. false false _375_ 0 4247 9 It's complicated false Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the IHF binding site and ends 6 pb after the -10 box. false Axel Nystrom annotation2006718 1 NarL range2006718 1 57 63 annotation2006717 1 Fnr range2006717 1 54 67 annotation2006711 1 -10 range2006711 1 126 133 annotation2006712 1 -35 range2006712 1 98 106 annotation2006713 1 Fnr range2006713 1 92 105 annotation2006714 1 Fis range2006714 1 88 106 annotation2006716 1 NarL range2006716 1 34 45 annotation2006719 1 NarL range2006719 1 47 53 annotation2006710 1 IHF range2006710 1 4 16 annotation2006715 1 NarL range2006715 1 70 76 BBa_K239005_sequence 1 gcaccgtgaaaaatctcataatttttatgaagtcactgtactcactatgggtaatgataaatatcaatgatagataaagttatcttatcgtttgatttacatcaaattgcctttagctacagacactaaggtggcagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z