BBa_K239007 1 BBa_K239007 Misfolded protein promoter 2009-08-04T11:00:00Z 2015-05-08T01:11:36Z Here is a link to the source: http://biocyc.org/ECOLI/NEW-IMAGE?type=ENZYME&object=EG11534-MONOMER IbpA is a small heat shock protein that binds to aggregated proteins and inclusion bodies formed during heterologous protein expression. Mutants lacking IbpA show a growth defect at elevated temperatures. IbpA/IbpB, ClpB, and the DnaK system form a functional triade of chaperones. false false _375_ 0 4513 9 Not in stock false In order to retrieve the correct sigma binding site, we decided to use a longer sequence than the actual promoter. false Anike Akinrinlade BBa_K239007_sequence 1 ggtttcatcgtcgccaatcatggttgcgctggcgcgggtgccgggatacgttccttctttccctccggtatgggacatcacgctggagcatcctccgagtaatgtcattccgctgcatatcatgaacgctaacaacacatttcttatcataataaattcatctgttgatcgtgggtgttggcctgatgagttatagcgatcccttgctgaaaataacatcatcattacgtcgcactgtggcggctatcgcactttaacgtttcgtgctgccccctcagtctatgcaatagaccataaactgcaaaaaaaagtccgctgataaggcttgaaaagttcatttccagacccatttttacatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z