BBa_K239008 1 BBa_K239008 RBS from RpoS 2009-08-16T11:00:00Z 2015-05-08T01:11:36Z Genomic sequence from biocyc.org database. Escherichia coli K-12 substr. MG1655 Native unmodified RBS for RpoS, but RpoS transcription can be initiated at more than one position. Hence other native RBS are also possible. RpoS is regulated on a posttranscriptional level by DksA, ppGpp, RprA and DsrA. false false _375_ 0 4247 9 Not in stock false Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. false Axel Nystrom annotation2017429 1 DsrA: translational unblocking range2017429 1 449 471 annotation2017428 1 CRP-cAMP range2017428 1 45 66 annotation2017430 1 RprA: translational unblocking range2017430 1 451 474 annotation2017427 1 ArcA repressor range2017427 1 17 31 BBa_K239008_sequence 1 ttcgggtgaacagagtgctaacaaaatgttgccgaacaacaagccaactgcgaccacggtcacagcgcctgtaacggtaccaacagcaagcacaaccgagccgactgtcagcagtacatcaaccagtacgcctatctccacctggcgctggccgactgagggcaaagtgatcgaaacctttggcgcttctgaggggggcaacaaggggattgatatcgcaggcagcaaaggacaggcaattatcgcgaccgcagatggccgcgttgtttatgctggtaacgcgctgcgcggctacggtaatctgattatcatcaaacataatgatgattacctgagtgcctacgcccataacgacacaatgctggtccgggaacaacaagaagttaaggcggggcaaaaaatagcgaccatgggtagcaccggaaccagttcaacacgcttgcattttgaaattcgttacaaggggaaatccgtaaacccgctgcgttatttgccgcagcgataaatcggcggaaccaggcttttgcttgaatgttccgtcaagggatcacgggtaggagccacctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z