BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K239001 1 BBa_K239001 Spy promoter, activated by Phosporylated CpxR, BaeR and Sigma70 2009-06-21T11:00:00Z 2015-05-08T01:11:36Z Genomic sequence from biocyc, Escherichia coli K-12. Native unmodified sequence. Sequence contains 2 phosphorylated BaeR binding sites, 1 phosphorylated CpxR binding site and transcription is initiated by sigma factor 70. Function: Can detect various periplasmic stresses. Area of application: Hopefully it can be used to detect presence of relevant unfolded proteins in the periplasmic space, to detect shear stress or other so far undefined relevant stress. false false _375_ 0 4247 9 It's complicated true Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the first BaeR binding site and ends 5 pb after the -10 box. false Axel Nystrom annotation2006307 1 BaeR range2006307 1 4 22 annotation2006306 1 -35 range2006306 1 128 136 annotation2006309 1 CpxR range2006309 1 107 120 annotation2006308 1 BaeR range2006308 1 66 81 annotation2006305 1 -10 range2006305 1 150 157 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K239009 1 BBa_K239009 GFP test devise for Spy promoter 2009-09-05T11:00:00Z 2015-05-08T01:11:36Z ... Hopefully the spy promoter can be used to detect presence of relevant unfolded proteins in the periplasmic space, to detect shear stress or other so far undefined relevant stress. false false _375_ 0 5136 9 It's complicated true ... false Xiang Chen component2018815 1 BBa_E0040 component2018811 1 BBa_K239001 component2018816 1 BBa_B0010 component2018818 1 BBa_B0012 component2018813 1 BBa_B0034 annotation2018813 1 BBa_B0034 range2018813 1 171 182 annotation2018818 1 BBa_B0012 range2018818 1 1005 1045 annotation2018815 1 BBa_E0040 range2018815 1 189 908 annotation2018811 1 BBa_K239001 range2018811 1 1 162 annotation2018816 1 BBa_B0010 range2018816 1 917 996 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K239009_sequence 1 agttcttcataatctctgcaaaatcatcgtgttgtaatattctctcatcactctccatcaaattttctttttttctccataattggcgcaaaagtgttttttacactttcattgttttaccgttgctctgattaattgacgctaaagtcagtaaagttaatctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K239001_sequence 1 agttcttcataatctctgcaaaatcatcgtgttgtaatattctctcatcactctccatcaaattttctttttttctccataattggcgcaaaagtgttttttacactttcattgttttaccgttgctctgattaattgacgctaaagtcagtaaagttaatc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z