BBa_K241001 1 BBa_K241001 phiC31 attB TT 2009-10-18T11:00:00Z 2015-05-08T01:11:37Z Primers were designed with the site and amplified to create double stranded fragments with prefix and suffix. A recognition site for the phage integrase that belongs on the donor plasmid, used for a site specific recombination, specifically, Integrase Mediated Cassette Exchange. false true _334_ 0 5518 9 It's complicated false Synthetic oligonucleotides do not have a free 5` phosphate. In order for the ligation of annealed linkers to the annealed att site oligos to be successful at least one set of oligos must be phosphorylated. T4 polynucleotide kinase can work for this purpose. false John Heil annotation2056274 1 attB TT range2056274 1 1 35 annotation2056275 1 core dinucleotide range2056275 1 18 19 BBa_K241001_sequence 1 ggtgccagggcgtgcccttgggctccccgggcgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z