BBa_K241003 1 BBa_K241003 phiC31 attB GA 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z synthetic recombination site of phiC31 integrase. Functions as the bacterial recombination site in natural phage infection. Contains a core dinucleotide mutation so that its recombination specificity is changed. Recombines with attP GA. false false _334_ 0 3630 9 It's complicated false Changed the core dinucleotide to GA, conferring specificity to attP GA. http://2009.igem.org/Team:Waterloo/Project#Non-cross-reactive_att_sites false John Heil annotation2056229 1 attB GA range2056229 1 1 35 annotation2056230 1 core dinucleotide range2056230 1 18 19 BBa_K241003_sequence 1 ggtgccagggcgtgcccgagggctccccgggcgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z