BBa_K242000 1 Ogr Late P2 transcription activator ogr 2009-10-10T11:00:00Z 2015-05-08T01:11:37Z enterobacteria phage P4 genome The ogr protein is a key transcriptional regulator in the P2 P4 phage system. On one hand, it is a P2 replication-dependent inducer of the formation of capsid and tail proteins. On the other hand, it activates P4 sid operon which activates delta gene, capable of interacting with the same activation region as ogr. Therefore, late gene transcription is enhanced and hijacked by P4. This part is important to willingly activate production of phage P4 and therefore mediate the abundant multiplication of a P4 biobrick transduction vector. false false _340_ 0 4754 9 It's complicated true The part includes ogr orf along with its own rbs and a double terminator. false Luis Fernando Monta??o Guti??rrez annotation2033955 1 ogr orf range2033955 1 17 235 annotation2033956 1 double translation stop range2033956 1 233 238 annotation2033954 1 ogr native rbs range2033954 1 1 16 BBa_K242000_sequence 1 ggaagaggtgctcgcgatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z