BBa_K242001 1 P2 cox Phage P2 cox transcriptional activator 2009-10-10T11:00:00Z 2015-05-08T01:11:37Z Complete genome of enterobacteria phage P2, ncbi refseq id#.- NC_001895 Cox (Control of excision) is a coliphage P2 key regulator in charge of activating P4 Pll promoter, which leads transcription of the P4 replication operon. Another function for cox, hence its name, is to repress the activation of the inmunity repressor, which participates in P2 late gene induction, necessary for complete assembly of P4 viral particles. false false _340_ 0 4754 9 It's complicated false The cox gene was embedded inside an operon so we only took cox native RBS and orf. false Luis Fernando Monta??o Guti??rrez annotation2033953 1 cox orf range2033953 1 16 291 annotation2033951 1 native rbs for cox range2033951 1 1 15 annotation2033952 1 double terminator range2033952 1 289 294 BBa_K242001_sequence 1 gggctagaggacgacatgagcaagcaagtaacactcatgactgatgcgattccttatcaggagttcgcaaaactaataggaaaatcgacaggagcggttcgtcggatgatcgataaaggaaagctgcctgtaattgatatgaccgatccacaatcagcttcaggtcgtgcaggtgaatattgggtataccttccggcatggaataacggactaaaactggcttatgaaagccgccctaaagagattcgtgacggctggttgatgtggttaggtctcggtgaaccacgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z