BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K242002 1 BBa_K242002 P2 and P4 transactivators (cox & ogr) IPTG inducible 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z This part was assembled first by cloning cox and ogr which were in a strain called E. coli C-117 in registry backbones and using the standard assembly procedure, This part consist of two transactivators. P2 cox is an activator the production of P2 morphopoietic genes, this regulator also affects regulatory genes in phage P4; ogr false false _340_ 0 4700 9 Not in stock false NaN false Jos?? Mar??a Uriel Urquiza Garc??a component2056544 1 BBa_K242001 component2056530 1 BBa_R0010 component2056540 1 BBa_K242000 component2056547 1 BBa_B0012 component2056545 1 BBa_B0010 annotation2056547 1 BBa_B0012 range2056547 1 845 885 annotation2056545 1 BBa_B0010 range2056545 1 757 836 annotation2056544 1 BBa_K242001 range2056544 1 455 748 annotation2056530 1 BBa_R0010 range2056530 1 1 200 annotation2056540 1 BBa_K242000 range2056540 1 209 446 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_K242001 1 P2 cox Phage P2 cox transcriptional activator 2009-10-10T11:00:00Z 2015-05-08T01:11:37Z Complete genome of enterobacteria phage P2, ncbi refseq id#.- NC_001895 Cox (Control of excision) is a coliphage P2 key regulator in charge of activating P4 Pll promoter, which leads transcription of the P4 replication operon. Another function for cox, hence its name, is to repress the activation of the inmunity repressor, which participates in P2 late gene induction, necessary for complete assembly of P4 viral particles. false false _340_ 0 4754 9 It's complicated false The cox gene was embedded inside an operon so we only took cox native RBS and orf. false Luis Fernando Monta??o Guti??rrez annotation2033951 1 native rbs for cox range2033951 1 1 15 annotation2033952 1 double terminator range2033952 1 289 294 annotation2033953 1 cox orf range2033953 1 16 291 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K242000 1 Ogr Late P2 transcription activator ogr 2009-10-10T11:00:00Z 2015-05-08T01:11:37Z enterobacteria phage P4 genome The ogr protein is a key transcriptional regulator in the P2 P4 phage system. On one hand, it is a P2 replication-dependent inducer of the formation of capsid and tail proteins. On the other hand, it activates P4 sid operon which activates delta gene, capable of interacting with the same activation region as ogr. Therefore, late gene transcription is enhanced and hijacked by P4. This part is important to willingly activate production of phage P4 and therefore mediate the abundant multiplication of a P4 biobrick transduction vector. false false _340_ 0 4754 9 It's complicated true The part includes ogr orf along with its own rbs and a double terminator. false Luis Fernando Monta??o Guti??rrez annotation2033955 1 ogr orf range2033955 1 17 235 annotation2033954 1 ogr native rbs range2033954 1 1 16 annotation2033956 1 double translation stop range2033956 1 233 238 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K242002_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggaagaggtgctcgcgatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaataatactagaggggctagaggacgacatgagcaagcaagtaacactcatgactgatgcgattccttatcaggagttcgcaaaactaataggaaaatcgacaggagcggttcgtcggatgatcgataaaggaaagctgcctgtaattgatatgaccgatccacaatcagcttcaggtcgtgcaggtgaatattgggtataccttccggcatggaataacggactaaaactggcttatgaaagccgccctaaagagattcgtgacggctggttgatgtggttaggtctcggtgaaccacgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K242000_sequence 1 ggaagaggtgctcgcgatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K242001_sequence 1 gggctagaggacgacatgagcaagcaagtaacactcatgactgatgcgattccttatcaggagttcgcaaaactaataggaaaatcgacaggagcggttcgtcggatgatcgataaaggaaagctgcctgtaattgatatgaccgatccacaatcagcttcaggtcgtgcaggtgaatattgggtataccttccggcatggaataacggactaaaactggcttatgaaagccgccctaaagagattcgtgacggctggttgatgtggttaggtctcggtgaaccacgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z