BBa_K242003 1 BBa_K242003 POgr. Promoter induced by Ogr. 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Bacteriophage P4 Promoter with Binding site for the Ogr gene product. Promotes the transcription of the downstream gene. false false _340_ 0 4378 9 Not in stock true na false Jes??s Abraham Avelar Rivas annotation2057235 1 OgrP range2057235 1 1 71 BBa_K242003_sequence 1 ctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgccgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z