BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K242001 1 P2 cox Phage P2 cox transcriptional activator 2009-10-10T11:00:00Z 2015-05-08T01:11:37Z Complete genome of enterobacteria phage P2, ncbi refseq id#.- NC_001895 Cox (Control of excision) is a coliphage P2 key regulator in charge of activating P4 Pll promoter, which leads transcription of the P4 replication operon. Another function for cox, hence its name, is to repress the activation of the inmunity repressor, which participates in P2 late gene induction, necessary for complete assembly of P4 viral particles. false false _340_ 0 4754 9 It's complicated false The cox gene was embedded inside an operon so we only took cox native RBS and orf. false Luis Fernando Monta??o Guti??rrez annotation2033953 1 cox orf range2033953 1 16 291 annotation2033951 1 native rbs for cox range2033951 1 1 15 annotation2033952 1 double terminator range2033952 1 289 294 BBa_K242000 1 Ogr Late P2 transcription activator ogr 2009-10-10T11:00:00Z 2015-05-08T01:11:37Z enterobacteria phage P4 genome The ogr protein is a key transcriptional regulator in the P2 P4 phage system. On one hand, it is a P2 replication-dependent inducer of the formation of capsid and tail proteins. On the other hand, it activates P4 sid operon which activates delta gene, capable of interacting with the same activation region as ogr. Therefore, late gene transcription is enhanced and hijacked by P4. This part is important to willingly activate production of phage P4 and therefore mediate the abundant multiplication of a P4 biobrick transduction vector. false false _340_ 0 4754 9 It's complicated true The part includes ogr orf along with its own rbs and a double terminator. false Luis Fernando Monta??o Guti??rrez annotation2033955 1 ogr orf range2033955 1 17 235 annotation2033954 1 ogr native rbs range2033954 1 1 16 annotation2033956 1 double translation stop range2033956 1 233 238 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K242006 1 BBa_K242006 P4 and P2 transactivators (cox & ogr) 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Somthing Somtheing false false _340_ 0 4700 9 It's complicated true Somthing false Jos?? Mar??a Uriel Urquiza Garc??a component2057670 1 BBa_K242000 component2057671 1 BBa_B0010 component2057673 1 BBa_B0012 component2057666 1 BBa_K242001 annotation2057673 1 BBa_B0012 range2057673 1 637 677 annotation2057666 1 BBa_K242001 range2057666 1 1 294 annotation2057670 1 BBa_K242000 range2057670 1 303 540 annotation2057671 1 BBa_B0010 range2057671 1 549 628 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K242000_sequence 1 ggaagaggtgctcgcgatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K242006_sequence 1 gggctagaggacgacatgagcaagcaagtaacactcatgactgatgcgattccttatcaggagttcgcaaaactaataggaaaatcgacaggagcggttcgtcggatgatcgataaaggaaagctgcctgtaattgatatgaccgatccacaatcagcttcaggtcgtgcaggtgaatattgggtataccttccggcatggaataacggactaaaactggcttatgaaagccgccctaaagagattcgtgacggctggttgatgtggttaggtctcggtgaaccacgttaataatactagagggaagaggtgctcgcgatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K242001_sequence 1 gggctagaggacgacatgagcaagcaagtaacactcatgactgatgcgattccttatcaggagttcgcaaaactaataggaaaatcgacaggagcggttcgtcggatgatcgataaaggaaagctgcctgtaattgatatgaccgatccacaatcagcttcaggtcgtgcaggtgaatattgggtataccttccggcatggaataacggactaaaactggcttatgaaagccgccctaaagagattcgtgacggctggttgatgtggttaggtctcggtgaaccacgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z