BBa_K242100 1 BBa_K242100 T3 and T7 RNA polymerase promoter. (multipromoter sequence) 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Bacteriophages T3 and T7 genomes This promoters are induced by the RNA polymerases of the bacteriophages T3 and T7. false false _340_ 0 4378 9 Not in stock false They are not recognized by any endogenous transcription machinery. false Jes??s Abraham Avelar Rivas annotation2057295 1 T3 RNA polymerase promoter range2057295 1 30 45 annotation2057294 1 T7 RNA polymerase promoter range2057294 1 4 26 annotation2057296 1 rbs range2057296 1 55 66 BBa_K242100_sequence 1 tactaatacgactcactatagggagaaataccctcactaaagggactcgtgcagaaagaggagaaatactagaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z