BBa_K242250 1 BBa_K242250 antisense RNA targeting replication machineries of T3 and T7 bacteriophages 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Genomic DNA from bacteriophages T3 and T7 It contains two antisense RNAs targeting 5' region of genes involved in DNA replication in bacteriophages T3 and T7. The first part is targeting T3 DNA polymerase, the second is to traductionaly regulate the production of the protein gp2.5 which is a ssDNA binding protein essential for replication. false false _340_ 0 4378 9 Not in stock true We looked for any target that was mentioned as essential in the literature. We decided to attack phages in their replication process, because of the targets we found, so we reasoned that if the phage tries to replicate it???s genome the asRNA is going to block the process reducing dramatically the burst size or if the efficiency is high, there wont be any new phage. we looked for structures in RNAFold with high Gibbs energy values (the less negative, the better), we also checked that the structures were not blocking the RBS. false Jes??s Abraham Avelar Rivas annotation2055175 1 asRNA targeting T3 DNA polymerase range2055175 1 1 69 annotation2055176 1 asRNA targeting T7 gp2.5 range2055176 1 70 153 BBa_K242250_sequence 1 cctcaatgtcacttacgagcataatgccctcctttggtttcgtgctaaatgataatcataaaggccacccatgtaagcgtaaggttcagcggtacccagcgcagaggtgaaaatcttcttagccataatgttaatctcctttaggtttcgttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z