BBa_K242251 1 BBa_K242251 asRNA targeting to T7 and T3 replication machineries regulated by quorum sensing 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Other biobricks The production of the asRNA will be regulated by the presence of the HSL and LuxR, both of wich will form a complex in order to turn on the expression of this antisense. Now it contains transcriptional terminator. false false _340_ 0 4378 9 Not in stock false The secondary structures found in the new transcript are not modified by the transcriptional terminator. false Jes??s Abraham Avelar Rivas component2055229 1 BBa_B0010 component2055231 1 BBa_B0012 component2055222 1 BBa_R1062 annotation2055229 1 BBa_B0010 range2055229 1 226 305 annotation2055222 1 BBa_R1062 range2055222 1 1 56 annotation2055231 1 BBa_B0012 range2055231 1 314 354 BBa_R1062 1 lux pR Promoter, Standard (luxR and HSL regulated -- lux pR)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 [Note: This is the same part as R0062 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].</p> <p>Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false false _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file part=BBa_R0062>Image1.gif</bb_file>" width="614" height="362"><br><br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br> <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr<br> Drew Endy<br> annotation7077 1 BBa_R1062 range7077 1 1 56 annotation2100 1 start range2100 1 54 54 annotation2101 1 -35 range2101 1 20 25 annotation2098 1 LuxR/HSL range2098 1 1 20 annotation2099 1 -10 range2099 1 42 48 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R1062_sequence 1 acctgtaggatcgtacaggttgacacaagaaaatggtttgttgatactcgaataaa BBa_K242251_sequence 1 acctgtaggatcgtacaggttgacacaagaaaatggtttgttgatactcgaataaatactagagcctcaatgtcacttacgagcataatgccctcctttggtttcgtgctaaatgataatcataaaggccacccatgtaagcgtaaggttcagcggtacccagcgcagaggtgaaaatcttcttagccataatgttaatctcctttaggtttcgttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z