BBa_K242300 1 BBa_K242300 multi-Ler binding site +promoter 1 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Escherichia coli O157:H7 str. TW14359 This is a structural motif that functions as the binding site for multiple monomers of Lee encoded regulator, one of the key activators of the The locus of enterocite effacement (LEE) operons in Enteropathogenic (EPEC) and Enterohemorragic (EHEC) Escherichia coli. It contains a promoter in the 3' end region and doesn't contain a RBS. false true _340_ 0 4754 9 Not in stock false The precise location of the tss wasn't found, so the promoter will not be added as an element in the sequence. false Luis Fernando Monta??o Guti??rrez annotation2057802 1 multi-Ler binding region range2057802 1 11 141 BBa_K242300_sequence 1 agtatatcaagtgctatacgcagcagtaccttcactgtctcgcagcacaaaagcacacctaacacggtaaaaaccagctcacctttttctcccagcaacagtcctgccagtgcaacaactatttttaaggtaaaaaattcttatacagaatcaggacttcaacgtcccacatcttatactcagtcaagtatagaaaaaaacgctttacatcggcctctacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z