BBa_K243007 1 SL-Fok_A Short Linker-Fok_a 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Combinated by cloning. This part is the combination of the parts BBa_K243004(Short Linker) and the part BBa_K243000(the protein domain Foka). These combination allows a direct coupling of the protein domain to another part e.g. a tag for purification. The linker can secure a independent function of the protein domain when it is linked to another part. false false _352_ 0 4732 9 It's complicated false The length of the linker is important to guarantee the independent function of the protein domain when it is linked two another part. false Freiburg Bioware09 component2042072 1 BBa_K243000 component2042068 1 BBa_K243004 component2042070 1 BBa_B0105 annotation2042068 1 BBa_K243004 range2042068 1 1 12 annotation2042072 1 BBa_K243000 range2042072 1 19 597 annotation2042070 1 BBa_B0105 range2042070 1 13 18 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K243004 1 ShortLinke Short Linker (Gly-Gly-Ser-Gly) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This linker was used to connect two different parts. The sequence produced the aminoacids Gly-Gly-Ser-Gly. false true _352_ 0 4732 9 In stock false None. false Freiburg Bioware09 annotation2041881 1 Short Linker range2041881 1 1 12 BBa_K243000 1 Fok_a Protein domain (active) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the active domain of our universal restriction endonuclease. It cut double stranded DNA, when it fused with the inactive protein domain of our universal restriction endonuclease(BBa_K243001). false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic active heterodimer) -heterodimeric aminio acids * switch Glutamate 490/310-312 to Lysin (GAA->AAA) * switch isoleucin 538/454-456 to Lysin (ATC->AAA) false Freiburg Bioware09 annotation2041869 1 Fok_a range2041869 1 1 579 BBa_B0105_sequence 1 accggc BBa_K243004_sequence 1 ggtggttctggt BBa_K243007_sequence 1 ggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K243000_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z