BBa_K243001 1 Fok_i Protein domain (inactive) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the inactive domain of our universal restriction endonuclease. It fused with the active protein domain of our universal restriction endonuclease(BBa_K243000)and linked with specific oligos. false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic inactive heterodimer) -heterodimeric amino acids * switch Glutamin 486/298-300 to Glutamate (CAA->GAA) * switch Isoleucin 499/337-339 to Leucin (ATC->CTG) -catalytic amino acids * switch Aspartate 450/190-192 to Alanin (GAC->GCG) * switch Aspartate 467/243-245 to Alanin (GAT->GCG) false Freiburg Bioware09 annotation2041872 1 Fok_i range2041872 1 1 579 BBa_K243006 1 LongLinker Long Linker (Gly-Gly-Ser-Gly)x3 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. We used this part to connect our protein domains with our lipocalin domains, for our project the universal endonuclease.The sequence produced the aminoacids Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly. false false _352_ 0 4732 9 It's complicated false None. false Freiburg Bioware09 annotation2041937 1 Long Linker range2041937 1 1 36 BBa_K243009 1 LongLinker Long Linker-Fok_i 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Combinated by cloning. This part is the combination of the parts BBa_K243006(Long Linker) and the part BBa_K243001(the protein domain Foka). These combination allows a direct coupling of the protein domain to another part e.g. a tag for purification. The linker can secure a independent function of the protein domain when it is linked to another part. false false _352_ 0 4732 9 It's complicated false The length of the linker is important to guarantee the independent function of the protein domain when it is linked two another part. false Freiburg Bioware09 component2055753 1 BBa_K243006 component2055755 1 BBa_B0105 component2055757 1 BBa_K243001 annotation2055757 1 BBa_K243001 range2055757 1 43 621 annotation2055755 1 BBa_B0105 range2055755 1 37 42 annotation2055753 1 BBa_K243006 range2055753 1 1 36 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K243001_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K243006_sequence 1 ggtggttctggtggtggttctggtggtggttctggt BBa_K243009_sequence 1 ggtggttctggtggtggttctggtggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z