BBa_K157012 1 BBa_K157012 Strep affinity tag II; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Strep tag as NgoMIV / AgeI protein fusion part, fusion to proteins facilitates detection, purification, immobilization. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2041866 1 Strep-Tag II range2041866 1 1 24 annotation2041865 1 Strep-Tag II range2041865 1 1 24 BBa_K243001 1 Fok_i Protein domain (inactive) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the inactive domain of our universal restriction endonuclease. It fused with the active protein domain of our universal restriction endonuclease(BBa_K243000)and linked with specific oligos. false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic inactive heterodimer) -heterodimeric amino acids * switch Glutamin 486/298-300 to Glutamate (CAA->GAA) * switch Isoleucin 499/337-339 to Leucin (ATC->CTG) -catalytic amino acids * switch Aspartate 450/190-192 to Alanin (GAC->GCG) * switch Aspartate 467/243-245 to Alanin (GAT->GCG) false Freiburg Bioware09 annotation2041872 1 Fok_i range2041872 1 1 579 BBa_K243005 1 MiddleLink Middle Linker ( Gly-Gly-Ser-Gly)x2 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. We used this part to connect our protein domains with our lipocalin domains, for our project the universal endonuclease.The sequence produced the aminoacids Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly . false false _352_ 0 4732 9 It's complicated false None. false Freiburg Bioware09 annotation2041884 1 MiddleLinker range2041884 1 1 24 BBa_K243012 1 BBa_K243012 Strep-DigA-Middle Linker-Fok_i 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Combined the parts by serial cloning steps. These part units some of our parts. false false _352_ 0 4732 9 It's complicated false The choice of the linker, lipocalin tag and purification tag allows us serval different combinations. false Freiburg Bioware09 component2042179 1 BBa_K243005 component2042177 1 BBa_B0105 component2042181 1 BBa_B0105 component2042171 1 BBa_K157012 component2042175 1 BBa_K243003 component2042183 1 BBa_K243001 component2042173 1 BBa_B0105 annotation2042177 1 BBa_B0105 range2042177 1 583 588 annotation2042183 1 BBa_K243001 range2042183 1 619 1197 annotation2042173 1 BBa_B0105 range2042173 1 25 30 annotation2042175 1 BBa_K243003 range2042175 1 31 582 annotation2042179 1 BBa_K243005 range2042179 1 589 612 annotation2042181 1 BBa_B0105 range2042181 1 613 618 annotation2042171 1 BBa_K157012 range2042171 1 1 24 BBa_K243003 1 DigA Digoxigenin binding protein (DigA) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z synthesized by purimex Digoxigenin is a steroid extracted from the plant Digitalis purpurea and D.lanata. Digoxigenin modified oligonucleotides are widely used as high sensitivity probes for non-radioactive immunoassay s and hybridization experiments. These DIG-probes are monitored by anti-DIG antibodies. These antibodies only show cross-reactivity with blossoms and leaves of D. spec(sole natural sources for DIG) ??? so they are suitable for analysis of any other biological species. Anti-DIG antibodies are either modified with fluorescent dyes (direct detection) or with an enzyme (indirect detection via enzyme-substrate reaction). false false _352_ 0 4732 9 It's complicated true none false Freiburg Bioware09 annotation2041878 1 Digoxigenin tag range2041878 1 1 552 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K157012_sequence 1 tggagccatccgcagtttgaaaaa BBa_K243005_sequence 1 ggtggttctggtggtggttctggt BBa_K243001_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K243012_sequence 1 tggagccatccgcagtttgaaaaaaccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaagaccggcggtggttctggtggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K243003_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z