BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K243014 1 BBa_K243014 His-FluA-Middle Linker-Fok_i 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Combined the parts by serial cloning steps. These part units some of our parts. The combination of a Histidin-Tag, a Lipocalin-Tag and the linked protein domain foka, make it possible to purifier and detect the function of the protein in one step. The fluorescineA tag allows the measurement by quenching and the coupling to a anticalin linked oligo. false false _352_ 0 4732 9 It's complicated false The choice of the linker, lipocalin tag and purification tag allows us several different combinations. false Freiburg Bioware09 component2042338 1 BBa_K157011 component2042344 1 BBa_B0105 component2042342 1 BBa_K157004 component2042340 1 BBa_B0105 component2042350 1 BBa_K243001 component2042348 1 BBa_B0105 component2042346 1 BBa_K243005 annotation2042348 1 BBa_B0105 range2042348 1 577 582 annotation2042340 1 BBa_B0105 range2042340 1 19 24 annotation2042344 1 BBa_B0105 range2042344 1 547 552 annotation2042346 1 BBa_K243005 range2042346 1 553 576 annotation2042342 1 BBa_K157004 range2042342 1 25 546 annotation2042338 1 BBa_K157011 range2042338 1 1 18 annotation2042350 1 BBa_K243001 range2042350 1 583 1161 BBa_K243001 1 Fok_i Protein domain (inactive) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the inactive domain of our universal restriction endonuclease. It fused with the active protein domain of our universal restriction endonuclease(BBa_K243000)and linked with specific oligos. false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic inactive heterodimer) -heterodimeric amino acids * switch Glutamin 486/298-300 to Glutamate (CAA->GAA) * switch Isoleucin 499/337-339 to Leucin (ATC->CTG) -catalytic amino acids * switch Aspartate 450/190-192 to Alanin (GAC->GCG) * switch Aspartate 467/243-245 to Alanin (GAT->GCG) false Freiburg Bioware09 annotation2041872 1 Fok_i range2041872 1 1 579 BBa_K243005 1 MiddleLink Middle Linker ( Gly-Gly-Ser-Gly)x2 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. We used this part to connect our protein domains with our lipocalin domains, for our project the universal endonuclease.The sequence produced the aminoacids Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly . false false _352_ 0 4732 9 It's complicated false None. false Freiburg Bioware09 annotation2041884 1 MiddleLinker range2041884 1 1 24 BBa_K157004 1 BBa_K157004 Fluoresceine-A-binding 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by GeneArt, optimized for expression in homo sapiens. Fluoresceine A -binding derivative of a Lipocalin (BBP, bilin binding protein from pieris brassicae), originally designed by Arne Skerra [see Ref. 1,2]. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040659 1 Lipocalin FluA range2040659 1 1 522 BBa_K157011 1 His His affinity tag; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 His-tag; fusion to proteins facilitates detection, purification, immobilization; NgoMIV / AgeI protein fusion part. false true _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2040626 1 His-Tag range2040626 1 1 18 BBa_B0105_sequence 1 accggc BBa_K243005_sequence 1 ggtggttctggtggtggttctggt BBa_K243001_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K157011_sequence 1 catcatcatcatcatcat BBa_K243014_sequence 1 catcatcatcatcatcataccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaacaccggcggtggttctggtggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K157004_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z