BBa_K243001 1 Fok_i Protein domain (inactive) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the inactive domain of our universal restriction endonuclease. It fused with the active protein domain of our universal restriction endonuclease(BBa_K243000)and linked with specific oligos. false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic inactive heterodimer) -heterodimeric amino acids * switch Glutamin 486/298-300 to Glutamate (CAA->GAA) * switch Isoleucin 499/337-339 to Leucin (ATC->CTG) -catalytic amino acids * switch Aspartate 450/190-192 to Alanin (GAC->GCG) * switch Aspartate 467/243-245 to Alanin (GAT->GCG) false Freiburg Bioware09 annotation2041872 1 Fok_i range2041872 1 1 579 BBa_K157011 1 His His affinity tag; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 His-tag; fusion to proteins facilitates detection, purification, immobilization; NgoMIV / AgeI protein fusion part. false true _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2040626 1 His-Tag range2040626 1 1 18 BBa_K243006 1 LongLinker Long Linker (Gly-Gly-Ser-Gly)x3 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. We used this part to connect our protein domains with our lipocalin domains, for our project the universal endonuclease.The sequence produced the aminoacids Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly. false false _352_ 0 4732 9 It's complicated false None. false Freiburg Bioware09 annotation2041937 1 Long Linker range2041937 1 1 36 BBa_K157004 1 BBa_K157004 Fluoresceine-A-binding 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by GeneArt, optimized for expression in homo sapiens. Fluoresceine A -binding derivative of a Lipocalin (BBP, bilin binding protein from pieris brassicae), originally designed by Arne Skerra [see Ref. 1,2]. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040659 1 Lipocalin FluA range2040659 1 1 522 BBa_K243016 1 BBa_K243016 His-FluA-Long Linker-Fok_i 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Combined the parts by serial cloning steps. These part units some of our parts. The combination of a Histidin-Tag, a Lipocalin-Tag and the linked protein domain foka, make it possible to purifier and detect the function of the protein in one step. The fluorescineA tag allows the measurement by quenching and the coupling to a anticalin linked oligo. false false _352_ 0 4732 9 It's complicated false The choice of the linker, lipocalin tag and purification tag allows us several different combinations. false Freiburg Bioware09 component2042670 1 BBa_B0105 component2042664 1 BBa_K157004 component2042662 1 BBa_B0105 component2042672 1 BBa_K243001 component2042668 1 BBa_K243006 component2042660 1 BBa_K157011 component2042666 1 BBa_B0105 annotation2042670 1 BBa_B0105 range2042670 1 589 594 annotation2042668 1 BBa_K243006 range2042668 1 553 588 annotation2042664 1 BBa_K157004 range2042664 1 25 546 annotation2042662 1 BBa_B0105 range2042662 1 19 24 annotation2042660 1 BBa_K157011 range2042660 1 1 18 annotation2042666 1 BBa_B0105 range2042666 1 547 552 annotation2042672 1 BBa_K243001 range2042672 1 595 1173 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K243016_sequence 1 catcatcatcatcatcataccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaacaccggcggtggttctggtggtggttctggtggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K243001_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K243006_sequence 1 ggtggttctggtggtggttctggtggtggttctggt BBa_K157011_sequence 1 catcatcatcatcatcat BBa_K157004_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z