BBa_K157009 1 linker Split fluorophore linker; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 Originally, this linker was used for fusion to the N-terminus of the C-terminal half of split fluorophores: Protein interactions can be examined by BiFC[1] using complementary, non-fluorescent fragments of fluorophores[2]. Therefore, it is essential that the C-terminal fragment of the fluorophore is not restricted too much in its mobility. The linker allows orientation and adaption of the C-terminal fragment to the N-terminal fragment of the split fluorophore and, thus, the reassembly of a working fluorescent protein. It has already been used in BiFC assays and is known to serve this purpose well[3]; anyway, another, more flexible linker that could be used instead is our ???GGGGS-linker??? (Part Bba_K157010).References see "Part Design". false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040643 1 Split-Fluorophore Linker range2040643 1 1 51 BBa_K243003 1 DigA Digoxigenin binding protein (DigA) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z synthesized by purimex Digoxigenin is a steroid extracted from the plant Digitalis purpurea and D.lanata. Digoxigenin modified oligonucleotides are widely used as high sensitivity probes for non-radioactive immunoassay s and hybridization experiments. These DIG-probes are monitored by anti-DIG antibodies. These antibodies only show cross-reactivity with blossoms and leaves of D. spec(sole natural sources for DIG) ??? so they are suitable for analysis of any other biological species. Anti-DIG antibodies are either modified with fluorescent dyes (direct detection) or with an enzyme (indirect detection via enzyme-substrate reaction). false false _352_ 0 4732 9 It's complicated true none false Freiburg Bioware09 annotation2041878 1 Digoxigenin tag range2041878 1 1 552 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K243000 1 Fok_a Protein domain (active) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the active domain of our universal restriction endonuclease. It cut double stranded DNA, when it fused with the inactive protein domain of our universal restriction endonuclease(BBa_K243001). false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic active heterodimer) -heterodimeric aminio acids * switch Glutamate 490/310-312 to Lysin (GAA->AAA) * switch isoleucin 538/454-456 to Lysin (ATC->AAA) false Freiburg Bioware09 annotation2041869 1 Fok_a range2041869 1 1 579 BBa_K157012 1 BBa_K157012 Strep affinity tag II; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Strep tag as NgoMIV / AgeI protein fusion part, fusion to proteins facilitates detection, purification, immobilization. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2041866 1 Strep-Tag II range2041866 1 1 24 annotation2041865 1 Strep-Tag II range2041865 1 1 24 BBa_K243017 1 BBa_K243017 Strep-DigA-Split Linker-Fok_a 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Combined the parts by serial cloning steps. These part units some of our parts. The combination of a Histidin-Tag, a Lipocalin-Tag and the linked protein domain foka, make it possible to purifier and detect the function of the protein in one step. The fluorescineA tag allows the measurement by quenching and the coupling to a anticalin linked oligo. false false _352_ 0 4732 9 It's complicated true The choice of the linker, lipocalin tag and purification tag allows us several different combinations. false Freiburg Bioware09 component2042687 1 BBa_K243000 component2042683 1 BBa_K157009 component2042685 1 BBa_B0105 component2042677 1 BBa_B0105 component2042679 1 BBa_K243003 component2042681 1 BBa_B0105 component2042675 1 BBa_K157012 annotation2042687 1 BBa_K243000 range2042687 1 646 1224 annotation2042683 1 BBa_K157009 range2042683 1 589 639 annotation2042681 1 BBa_B0105 range2042681 1 583 588 annotation2042675 1 BBa_K157012 range2042675 1 1 24 annotation2042685 1 BBa_B0105 range2042685 1 640 645 annotation2042677 1 BBa_B0105 range2042677 1 25 30 annotation2042679 1 BBa_K243003 range2042679 1 31 582 BBa_B0105_sequence 1 accggc BBa_K157012_sequence 1 tggagccatccgcagtttgaaaaa BBa_K243000_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K243003_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaag BBa_K243017_sequence 1 tggagccatccgcagtttgaaaaaaccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaagaccggccgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcacaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K157009_sequence 1 cgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z