BBa_K243020 1 Strep_Dig Strep-DigA 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z false false _9_ 0 4732 9 It's complicated false false Freiburg Bioware09 component2047283 1 BBa_B0105 component2047281 1 BBa_K157012 component2047285 1 BBa_K243003 annotation2047281 1 BBa_K157012 range2047281 1 1 24 annotation2047283 1 BBa_B0105 range2047283 1 25 30 annotation2047285 1 BBa_K243003 range2047285 1 31 582 BBa_K243003 1 DigA Digoxigenin binding protein (DigA) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z synthesized by purimex Digoxigenin is a steroid extracted from the plant Digitalis purpurea and D.lanata. Digoxigenin modified oligonucleotides are widely used as high sensitivity probes for non-radioactive immunoassay s and hybridization experiments. These DIG-probes are monitored by anti-DIG antibodies. These antibodies only show cross-reactivity with blossoms and leaves of D. spec(sole natural sources for DIG) ??? so they are suitable for analysis of any other biological species. Anti-DIG antibodies are either modified with fluorescent dyes (direct detection) or with an enzyme (indirect detection via enzyme-substrate reaction). false false _352_ 0 4732 9 It's complicated true none false Freiburg Bioware09 annotation2041878 1 Digoxigenin tag range2041878 1 1 552 BBa_K157012 1 BBa_K157012 Strep affinity tag II; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Strep tag as NgoMIV / AgeI protein fusion part, fusion to proteins facilitates detection, purification, immobilization. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2041866 1 Strep-Tag II range2041866 1 1 24 annotation2041865 1 Strep-Tag II range2041865 1 1 24 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K157012_sequence 1 tggagccatccgcagtttgaaaaa BBa_K243020_sequence 1 tggagccatccgcagtttgaaaaaaccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaag BBa_K243003_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z