BBa_K157011 1 His His affinity tag; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 His-tag; fusion to proteins facilitates detection, purification, immobilization; NgoMIV / AgeI protein fusion part. false true _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2040626 1 His-Tag range2040626 1 1 18 BBa_K157009 1 linker Split fluorophore linker; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 Originally, this linker was used for fusion to the N-terminus of the C-terminal half of split fluorophores: Protein interactions can be examined by BiFC[1] using complementary, non-fluorescent fragments of fluorophores[2]. Therefore, it is essential that the C-terminal fragment of the fluorophore is not restricted too much in its mobility. The linker allows orientation and adaption of the C-terminal fragment to the N-terminal fragment of the split fluorophore and, thus, the reassembly of a working fluorescent protein. It has already been used in BiFC assays and is known to serve this purpose well[3]; anyway, another, more flexible linker that could be used instead is our ???GGGGS-linker??? (Part Bba_K157010).References see "Part Design". false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040643 1 Split-Fluorophore Linker range2040643 1 1 51 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K243002 1 DsbA DsbA signal sequence (enables periplasm export) 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z Sequence of the DsbA was copied out from E.coli B genom Synthesized oligos with signal sequence of DsbA by sigma. The signal sequence of DsbA linked to an cds of e.g.a protein, applies the exportation of the protein to the periplasm. The accumulation of the expressed protein in the periplasm, can be used for the purification of the protein. false false _352_ 0 4732 9 It's complicated false the signal sequence had to be located at the N-terminus of the (fusion)protein. false Freiburg Bioware09 annotation2041875 1 Dsba signal sequence range2041875 1 1 54 BBa_K243003 1 DigA Digoxigenin binding protein (DigA) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z synthesized by purimex Digoxigenin is a steroid extracted from the plant Digitalis purpurea and D.lanata. Digoxigenin modified oligonucleotides are widely used as high sensitivity probes for non-radioactive immunoassay s and hybridization experiments. These DIG-probes are monitored by anti-DIG antibodies. These antibodies only show cross-reactivity with blossoms and leaves of D. spec(sole natural sources for DIG) ??? so they are suitable for analysis of any other biological species. Anti-DIG antibodies are either modified with fluorescent dyes (direct detection) or with an enzyme (indirect detection via enzyme-substrate reaction). false false _352_ 0 4732 9 It's complicated true none false Freiburg Bioware09 annotation2041878 1 Digoxigenin tag range2041878 1 1 552 BBa_K243000 1 Fok_a Protein domain (active) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the active domain of our universal restriction endonuclease. It cut double stranded DNA, when it fused with the inactive protein domain of our universal restriction endonuclease(BBa_K243001). false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic active heterodimer) -heterodimeric aminio acids * switch Glutamate 490/310-312 to Lysin (GAA->AAA) * switch isoleucin 538/454-456 to Lysin (ATC->AAA) false Freiburg Bioware09 annotation2041869 1 Fok_a range2041869 1 1 579 BBa_K243021 1 BBa_K243021 DsbA-His-DigA-Split Linker-Fok_a 2009-10-17T11:00:00Z 2015-05-08T01:11:37Z Combined by serial cloning steps. The DsbA tag is used to transfer the produced protein into the periplasm. This makes is easier for us to extract the protein. false false _352_ 0 4732 9 It's complicated false none. false Freiburg Bioware09 component2051197 1 BBa_K243002 component2051201 1 BBa_K157011 component2051203 1 BBa_B0105 component2051209 1 BBa_K157009 component2051211 1 BBa_K243000 component2051199 1 BBa_B0105 component2051205 1 BBa_K243003 component2051207 1 BBa_B0105 annotation2051197 1 BBa_K243002 range2051197 1 1 54 annotation2051205 1 BBa_K243003 range2051205 1 85 636 annotation2051203 1 BBa_B0105 range2051203 1 79 84 annotation2051209 1 BBa_K157009 range2051209 1 643 693 annotation2051201 1 BBa_K157011 range2051201 1 61 78 annotation2051211 1 BBa_K243000 range2051211 1 694 1272 annotation2051199 1 BBa_B0105 range2051199 1 55 60 annotation2051207 1 BBa_B0105 range2051207 1 637 642 BBa_B0105_sequence 1 accggc BBa_K243021_sequence 1 aaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgaccggccatcatcatcatcatcataccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaagaccggccgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcacaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K157011_sequence 1 catcatcatcatcatcat BBa_K243000_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K243003_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaag BBa_K243002_sequence 1 aaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcg BBa_K157009_sequence 1 cgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z