BBa_K243024 1 BBa_K243024 Strep-FluA-Middle Linker-Fok_a 2009-10-17T11:00:00Z 2015-05-08T01:11:37Z Combined by serial clonig steps. This combination of parts use the benefits of an Strep-tag and is linked with a FluroescineA tag. The MiddleLinker (GlySerGlyGly)x2 produce a certain distance between the FluA tag and the protein domain Fok_a. false false _352_ 0 4732 9 It's complicated false The linker length and the choice of the purification tag in combination with the anticalin tag allowed us several combination possiblities, which we had to prove to achieve the best combiantion. false Freiburg Bioware09 component2051354 1 BBa_B0105 component2051348 1 BBa_K157012 component2051360 1 BBa_K243000 component2051356 1 BBa_K243005 component2051358 1 BBa_B0105 component2051352 1 BBa_K157004 component2051350 1 BBa_B0105 annotation2051348 1 BBa_K157012 range2051348 1 1 24 annotation2051350 1 BBa_B0105 range2051350 1 25 30 annotation2051360 1 BBa_K243000 range2051360 1 589 1167 annotation2051352 1 BBa_K157004 range2051352 1 31 552 annotation2051356 1 BBa_K243005 range2051356 1 559 582 annotation2051354 1 BBa_B0105 range2051354 1 553 558 annotation2051358 1 BBa_B0105 range2051358 1 583 588 BBa_K157012 1 BBa_K157012 Strep affinity tag II; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Strep tag as NgoMIV / AgeI protein fusion part, fusion to proteins facilitates detection, purification, immobilization. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2041866 1 Strep-Tag II range2041866 1 1 24 annotation2041865 1 Strep-Tag II range2041865 1 1 24 BBa_K243005 1 MiddleLink Middle Linker ( Gly-Gly-Ser-Gly)x2 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. We used this part to connect our protein domains with our lipocalin domains, for our project the universal endonuclease.The sequence produced the aminoacids Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly . false false _352_ 0 4732 9 It's complicated false None. false Freiburg Bioware09 annotation2041884 1 MiddleLinker range2041884 1 1 24 BBa_K243000 1 Fok_a Protein domain (active) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the active domain of our universal restriction endonuclease. It cut double stranded DNA, when it fused with the inactive protein domain of our universal restriction endonuclease(BBa_K243001). false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic active heterodimer) -heterodimeric aminio acids * switch Glutamate 490/310-312 to Lysin (GAA->AAA) * switch isoleucin 538/454-456 to Lysin (ATC->AAA) false Freiburg Bioware09 annotation2041869 1 Fok_a range2041869 1 1 579 BBa_K157004 1 BBa_K157004 Fluoresceine-A-binding 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by GeneArt, optimized for expression in homo sapiens. Fluoresceine A -binding derivative of a Lipocalin (BBP, bilin binding protein from pieris brassicae), originally designed by Arne Skerra [see Ref. 1,2]. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040659 1 Lipocalin FluA range2040659 1 1 522 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K157012_sequence 1 tggagccatccgcagtttgaaaaa BBa_K243005_sequence 1 ggtggttctggtggtggttctggt BBa_K243024_sequence 1 tggagccatccgcagtttgaaaaaaccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaacaccggcggtggttctggtggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K243000_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K157004_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z