BBa_K243030 1 BBa_K243030 SEG 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Ordered by Mr.Gene. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. The SEG linker was create to connect our protein domains Fok_a and Fok_i to an function final construct. false true _352_ 0 4732 9 It's complicated false Designed for the fusion of proteins or peptides via in frame cloning, according to RFC25 false Freiburg Bioware09 annotation2055436 1 SEG Linker range2055436 1 1 108 BBa_K243030_sequence 1 ggtggttctggcggcggttctgaaggtggcggctccgaaggcggcggcagcgagggcggtggtagcgaaggtggtggctccgagggtggcggttccggcggcggtagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z