BBa_K157011 1 His His affinity tag; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 His-tag; fusion to proteins facilitates detection, purification, immobilization; NgoMIV / AgeI protein fusion part. false true _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2040626 1 His-Tag range2040626 1 1 18 BBa_K157009 1 linker Split fluorophore linker; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 Originally, this linker was used for fusion to the N-terminus of the C-terminal half of split fluorophores: Protein interactions can be examined by BiFC[1] using complementary, non-fluorescent fragments of fluorophores[2]. Therefore, it is essential that the C-terminal fragment of the fluorophore is not restricted too much in its mobility. The linker allows orientation and adaption of the C-terminal fragment to the N-terminal fragment of the split fluorophore and, thus, the reassembly of a working fluorescent protein. It has already been used in BiFC assays and is known to serve this purpose well[3]; anyway, another, more flexible linker that could be used instead is our ???GGGGS-linker??? (Part Bba_K157010).References see "Part Design". false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040643 1 Split-Fluorophore Linker range2040643 1 1 51 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K243000 1 Fok_a Protein domain (active) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the active domain of our universal restriction endonuclease. It cut double stranded DNA, when it fused with the inactive protein domain of our universal restriction endonuclease(BBa_K243001). false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic active heterodimer) -heterodimeric aminio acids * switch Glutamate 490/310-312 to Lysin (GAA->AAA) * switch isoleucin 538/454-456 to Lysin (ATC->AAA) false Freiburg Bioware09 annotation2041869 1 Fok_a range2041869 1 1 579 BBa_K243036 1 BBa_K243036 His-Dig-Split Linker-Fok_a 2009-10-19T11:00:00Z 2015-05-08T01:11:38Z cloning His-Dig-Split-Fok_a in pjs419 false false _352_ 0 4732 9 It's complicated true SD false Freiburg Bioware09 component2055471 1 BBa_B0105 component2055473 1 BBa_K243000 component2055463 1 BBa_B0105 component2055469 1 BBa_K157009 component2055465 1 BBa_K243003 component2055467 1 BBa_B0105 component2055461 1 BBa_K157011 annotation2055473 1 BBa_K243000 range2055473 1 640 1218 annotation2055463 1 BBa_B0105 range2055463 1 19 24 annotation2055471 1 BBa_B0105 range2055471 1 634 639 annotation2055465 1 BBa_K243003 range2055465 1 25 576 annotation2055461 1 BBa_K157011 range2055461 1 1 18 annotation2055469 1 BBa_K157009 range2055469 1 583 633 annotation2055467 1 BBa_B0105 range2055467 1 577 582 BBa_K243003 1 DigA Digoxigenin binding protein (DigA) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z synthesized by purimex Digoxigenin is a steroid extracted from the plant Digitalis purpurea and D.lanata. Digoxigenin modified oligonucleotides are widely used as high sensitivity probes for non-radioactive immunoassay s and hybridization experiments. These DIG-probes are monitored by anti-DIG antibodies. These antibodies only show cross-reactivity with blossoms and leaves of D. spec(sole natural sources for DIG) ??? so they are suitable for analysis of any other biological species. Anti-DIG antibodies are either modified with fluorescent dyes (direct detection) or with an enzyme (indirect detection via enzyme-substrate reaction). false false _352_ 0 4732 9 It's complicated true none false Freiburg Bioware09 annotation2041878 1 Digoxigenin tag range2041878 1 1 552 BBa_B0105_sequence 1 accggc BBa_K157011_sequence 1 catcatcatcatcatcat BBa_K243000_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K243003_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaag BBa_K243036_sequence 1 catcatcatcatcatcataccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtggcaggtggccgcttatcccgaccacatcaccaagtacggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtcccggtacagcgtgatccacggcaaagagtacttcagcgagggcaccgcctaccctgtgggcgacagcaagatcggcaagatctaccacagctacaccatcggcggcgtgacccaggtgggcgtgagcaacgtgctgtccaccgacaacaagaactacatcatcggctacttttgcagatacgacgaggacaagaagggccactgggacgccgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttctccgaggccgcctgcaaagtgaacaacagcaactggtcccacccccagttcgaaaagaccggccgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcacaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K157009_sequence 1 cgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z