BBa_K245009 1 RFC 37 RFC 37 Scar Sequence 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z Of synthetic origin. The sequence codes the scar, that is introduced between two parts, ligated together after being cut with BspEI/NgoMIV. false false _337_ 0 4969 9 Not in stock false This sequence is introduced as scar as consequence of ligation of two parts, that were previously cut with BspEI/NgoMIV. false ??pela Miklavič annotation2027273 1 scar SG range2027273 1 1 6 BBa_K245010 1 BBa_K245010 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z hgdihg ngidfjkhg true false _337_ 0 4969 9 Discontinued false dgjkdghd false ??pela Miklavič BBa_K245012 1 BBa_K245012 --No description -- 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z fdhdhfdhg fhgfdhf true false _337_ 0 4969 9 Discontinued false dhdfhtgdh false ??pela Miklavič component2028129 1 BBa_K245010 component2028131 1 BBa_K245009 annotation2028131 1 BBa_K245009 range2028131 1 108 113 annotation2028129 1 BBa_K245010 range2028129 1 1 99 BBa_K245012_sequence 1 tccccagaagatgaaatccaagcactgaaacaggaaaatgcgcaactgaaagagaaaatccaacaactggaacaggaaattcaggctctgaagtatggctactagagtccggc BBa_K245009_sequence 1 tccggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z