BBa_K245009 1 RFC 37 RFC 37 Scar Sequence 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z Of synthetic origin. The sequence codes the scar, that is introduced between two parts, ligated together after being cut with BspEI/NgoMIV. false false _337_ 0 4969 9 Not in stock false This sequence is introduced as scar as consequence of ligation of two parts, that were previously cut with BspEI/NgoMIV. false ??pela Miklavič annotation2027273 1 scar SG range2027273 1 1 6 BBa_K245131 1 RFC 37 ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245059 1 RFC 37 LL37-ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:38Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič component2045464 1 BBa_K245114 component2045467 1 BBa_K245131 component2045466 1 BBa_K245009 annotation2045467 1 BBa_K245131 range2045467 1 118 267 annotation2045464 1 BBa_K245114 range2045464 1 1 111 annotation2045466 1 BBa_K245009 range2045466 1 112 117 BBa_K245114 1 RFC 37 LL37 2009-10-13T11:00:00Z 2016-01-27T02:41:54Z the part is of syntethic origin x false false _337_ 4206 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245114_sequence 1 ctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcc BBa_K245059_sequence 1 ctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctccggcgttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt BBa_K245009_sequence 1 tccggc BBa_K245131_sequence 1 gttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z