BBa_K245009 1 RFC 37 RFC 37 Scar Sequence 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z Of synthetic origin. The sequence codes the scar, that is introduced between two parts, ligated together after being cut with BspEI/NgoMIV. false false _337_ 0 4969 9 Not in stock false This sequence is introduced as scar as consequence of ligation of two parts, that were previously cut with BspEI/NgoMIV. false ??pela Miklavič annotation2027273 1 scar SG range2027273 1 1 6 BBa_K245131 1 RFC 37 ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245078 1 RFC 37 LL37-ELST-GCN-ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič component2045580 1 BBa_K245114 component2045583 1 BBa_K245131 component2045586 1 BBa_K245127 component2045582 1 BBa_K245009 component2045585 1 BBa_K245009 component2045588 1 BBa_K245009 component2045589 1 BBa_K245131 annotation2045586 1 BBa_K245127 range2045586 1 274 372 annotation2045585 1 BBa_K245009 range2045585 1 268 273 annotation2045580 1 BBa_K245114 range2045580 1 1 111 annotation2045582 1 BBa_K245009 range2045582 1 112 117 annotation2045589 1 BBa_K245131 range2045589 1 379 528 annotation2045588 1 BBa_K245009 range2045588 1 373 378 annotation2045583 1 BBa_K245131 range2045583 1 118 267 BBa_K245127 1 RFC 37 GCN 2009-10-13T11:00:00Z 2015-05-08T01:11:39Z the part is of syntethic origin x false true _337_ 0 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245114 1 RFC 37 LL37 2009-10-13T11:00:00Z 2016-01-27T02:41:54Z the part is of syntethic origin x false false _337_ 4206 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245114_sequence 1 ctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcc BBa_K245078_sequence 1 ctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctccggcgttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggttccggctccccagaagatgaaatccaagcactgaaacaggaaaatgcgcaactgaaagagaaaatccaacaactggaacaggaaattcaggctctgaagtatggctccggcgttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt BBa_K245127_sequence 1 tccccagaagatgaaatccaagcactgaaacaggaaaatgcgcaactgaaagagaaaatccaacaactggaacaggaaattcaggctctgaagtatggc BBa_K245009_sequence 1 tccggc BBa_K245131_sequence 1 gttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z