BBa_K245009 1 RFC 37 RFC 37 Scar Sequence 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z Of synthetic origin. The sequence codes the scar, that is introduced between two parts, ligated together after being cut with BspEI/NgoMIV. false false _337_ 0 4969 9 Not in stock false This sequence is introduced as scar as consequence of ligation of two parts, that were previously cut with BspEI/NgoMIV. false ??pela Miklavič annotation2027273 1 scar SG range2027273 1 1 6 BBa_K245121 1 RFC 37 P4 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245082 1 RFC 37 P4-ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič component2045605 1 BBa_K245009 component2045603 1 BBa_K245121 component2045606 1 BBa_K245131 annotation2045605 1 BBa_K245009 range2045605 1 100 105 annotation2045606 1 BBa_K245131 range2045606 1 106 255 annotation2045603 1 BBa_K245121 range2045603 1 1 99 BBa_K245131 1 RFC 37 ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245082_sequence 1 agcccggaagataaaattgctcagctgaaacaaaaaatccaagcgctgaaacaggaaaaccagcagctggaagaggaaaacgccgcactggaatatggttccggcgttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt BBa_K245121_sequence 1 agcccggaagataaaattgctcagctgaaacaaaaaatccaagcgctgaaacaggaaaaccagcagctggaagaggaaaacgccgcactggaatatggt BBa_K245009_sequence 1 tccggc BBa_K245131_sequence 1 gttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z