BBa_K245094 1 RFC 37 foldon-p53 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič component2045850 1 BBa_K245128 component2045849 1 BBa_K245009 component2045847 1 BBa_K245141 annotation2045850 1 BBa_K245128 range2045850 1 88 177 annotation2045849 1 BBa_K245009 range2045849 1 82 87 annotation2045847 1 BBa_K245141 range2045847 1 1 81 BBa_K245128 1 RFC 37 p53 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245141 1 RFC 37 foldon 2009-10-13T11:00:00Z 2015-05-08T01:11:39Z the part was multiplied using PCR x false false _337_ 0 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245009 1 RFC 37 RFC 37 Scar Sequence 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z Of synthetic origin. The sequence codes the scar, that is introduced between two parts, ligated together after being cut with BspEI/NgoMIV. false false _337_ 0 4969 9 Not in stock false This sequence is introduced as scar as consequence of ligation of two parts, that were previously cut with BspEI/NgoMIV. false ??pela Miklavič annotation2027273 1 scar SG range2027273 1 1 6 BBa_K245094_sequence 1 ggttatattcctgaagcaccacgtgatggccaagcatacgttcgtaaagacggtgaatgggtcctgctgtccactttcctgtccggcgaatactttaccctgcaaatccgtggccgtgagcgtttcgagatgttccgcgaactgaatgaagccctggaactgaaagatgctcaagca BBa_K245141_sequence 1 ggttatattcctgaagcaccacgtgatggccaagcatacgttcgtaaagacggtgaatgggtcctgctgtccactttcctg BBa_K245128_sequence 1 gaatactttaccctgcaaatccgtggccgtgagcgtttcgagatgttccgcgaactgaatgaagccctggaactgaaagatgctcaagca BBa_K245009_sequence 1 tccggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z