BBa_K245009 1 RFC 37 RFC 37 Scar Sequence 2009-09-27T11:00:00Z 2015-05-08T01:11:38Z Of synthetic origin. The sequence codes the scar, that is introduced between two parts, ligated together after being cut with BspEI/NgoMIV. false false _337_ 0 4969 9 Not in stock false This sequence is introduced as scar as consequence of ligation of two parts, that were previously cut with BspEI/NgoMIV. false ??pela Miklavič annotation2027273 1 scar SG range2027273 1 1 6 BBa_K245131 1 RFC 37 ELST 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245101 1 RFC 37 LL37-ELST-GCN-ELST-P1 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič component2045872 1 BBa_K245131 component2045866 1 BBa_K245131 component2045875 1 BBa_K245118 component2045871 1 BBa_K245009 component2045865 1 BBa_K245009 component2045868 1 BBa_K245009 component2045874 1 BBa_K245009 component2045863 1 BBa_K245114 component2045869 1 BBa_K245127 annotation2045865 1 BBa_K245009 range2045865 1 112 117 annotation2045863 1 BBa_K245114 range2045863 1 1 111 annotation2045869 1 BBa_K245127 range2045869 1 274 372 annotation2045866 1 BBa_K245131 range2045866 1 118 267 annotation2045872 1 BBa_K245131 range2045872 1 379 528 annotation2045875 1 BBa_K245118 range2045875 1 535 633 annotation2045874 1 BBa_K245009 range2045874 1 529 534 annotation2045868 1 BBa_K245009 range2045868 1 268 273 annotation2045871 1 BBa_K245009 range2045871 1 373 378 BBa_K245127 1 RFC 37 GCN 2009-10-13T11:00:00Z 2015-05-08T01:11:39Z the part is of syntethic origin x false true _337_ 0 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245118 1 RFC 37 P1 2009-10-15T11:00:00Z 2015-05-08T01:11:39Z x x false false _337_ 0 4969 9 It's complicated false x false ??pela Miklavič BBa_K245114 1 RFC 37 LL37 2009-10-13T11:00:00Z 2016-01-27T02:41:54Z the part is of syntethic origin x false false _337_ 4206 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245114_sequence 1 ctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcc BBa_K245118_sequence 1 agcccagaagacgaaattcaggcactggaagaagaaaatgctcaactggaacaggaaaacgcggcgctggaagaagaaatcgcacagctggaatacggc BBa_K245127_sequence 1 tccccagaagatgaaatccaagcactgaaacaggaaaatgcgcaactgaaagagaaaatccaacaactggaacaggaaattcaggctctgaagtatggc BBa_K245009_sequence 1 tccggc BBa_K245101_sequence 1 ctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctccggcgttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggttccggctccccagaagatgaaatccaagcactgaaacaggaaaatgcgcaactgaaagagaaaatccaacaactggaacaggaaattcaggctctgaagtatggctccggcgttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggttccggcagcccagaagacgaaattcaggcactggaagaagaaaatgctcaactggaacaggaaaacgcggcgctggaagaagaaatcgcacagctggaatacggc BBa_K245131_sequence 1 gttccgggtgttggtgttcctggcgtgggtgttcctggtgttggcgtgccaggtgtgggagtgccaggcgttggtgtaccgggtgtgggcgttccgggagtcggagttccgggagtaggcgtgcctggtgttggggttccgggtgtaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z