BBa_K245141 1 RFC 37 foldon 2009-10-13T11:00:00Z 2015-05-08T01:11:39Z the part was multiplied using PCR x false false _337_ 0 4964 9 It's complicated false This part is inserted in BB-NIC-II-HisN vector (BBa_K245005) and can be assembled with other parts according to assembly standard 37. false Nika Debeljak BBa_K245141_sequence 1 ggttatattcctgaagcaccacgtgatggccaagcatacgttcgtaaagacggtgaatgggtcctgctgtccactttcctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z