BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K249003 1 BBa_K249003 Lumazine Synthase 2009-08-25T11:00:00Z 2016-10-08T12:35:49Z A science paper? This is the Composite Part which creates the enzyme Lumazine Synthase. Lumazine SYnthase generates the product Lumazine which aggregates together to form a microcompartment, or synthetic organelle. The microcompartment has large negatively charged pores through which proteins containing positely charged Arginine Tags may be targetted. false true _342_ 31248 3171 9 Not in stock false point mutations to EcoRI and PstI sites? false Roxanne Shank component2060527 1 BBa_B0030 component2060530 1 BBa_B0010 component2060519 1 BBa_R0010 component2060532 1 BBa_B0012 component2060529 1 BBa_K249002 annotation2060532 1 BBa_B0012 range2060532 1 791 831 annotation2060519 1 BBa_R0010 range2060519 1 1 200 annotation2060529 1 BBa_K249002 range2060529 1 230 694 annotation2060527 1 BBa_B0030 range2060527 1 209 223 annotation2060530 1 BBa_B0010 range2060530 1 703 782 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_K249002 1 BBa_K249002 Lumazine Synthase 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z A Science Paper? Lumazine Synthase is an enzyme which creates Lumazine, a product which aggregates forming a hollow spheroid which can act as a mirocompartment, or artificial organelle. The Lumazine forms negatively charged pores, which can be used to introduce proteins. The proteins which are being introduced into the microcompartment must be equipped with an Arginine Tag. false false _242_342_ 0 3171 9 It's complicated true point mutations of EcoRI and PstI sites? false Roxanne Shank BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0030_sequence 1 attaaagaggagaaa BBa_K249003_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagattaaagaggagaaatactagatgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K249002_sequence 1 atgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z