BBa_K249005 1 BBa_K249005 C-terminal Arginine Fusion Vector 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z Synthesized DNA pSB1A3 with an C-terminal Arginine tag. This particular plasmid utilizes the BioFusion (aka Silver Lab) Standard for BioBrick assembly. Adds 10 Arginine residues to the C-terminus of a Protein (Includes Stop Codon) false false _342_ 0 3171 9 It's complicated true Standard false Roxanne Shank BBa_K249005_sequence 1 cgccgccgccgccgccgccgccgccgccgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z