BBa_K249026 1 BBa_K249026 Theophylline Riboswitch (Improved) 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z Synthesized DNA This is an improvement on the Theophylline Riboswitch submitted by the University of Lethbridge 2007 iGEM team. The theophylline Riboswithc binds to Theophylline in a specific manner to induce transcription of an mRNA. false false _342_ 0 3171 9 It's complicated false Standard false Roxanne Shank BBa_K249026_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z