BBa_K252000 1 BBa_K252000 MicA small RNA 2009-10-20T11:00:00Z 2015-05-08T01:11:40Z E. coli MG-1655 MicA is a regulatory small RNA. Its standard coding sequence is ligated to the lac promoter sequence (BBa_R0010)via blunt end ligation. Blunt end is necessary for function of small RNA. Restriction enzyme used for blunt end cutting is BfrBI (ATG/CAT). false false _344_ 0 3135 9 It's complicated false Attached to the lac promoter sequence (BBa_R0010) with a blunt end restriction site. Restriction enzyme used for blunt end cutting is BfrBI (ATG/CAT). false Graham Heimberg BBa_K252000_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacagttatatgcctttattgtcacagattttattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttttagaattggataatccttatccagagcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z