BBa_K252001 1 BBa_K252001 MicC small RNA 2009-10-20T11:00:00Z 2015-05-08T01:11:40Z E. coli MG-1655 MicC is a regulatory small RNA. Its standard coding sequence is a composite with the lac promoter sequence (BBa_R0010). false false _344_ 0 3135 9 It's complicated false Attached to the lac promoter sequence (BBa_R0010). Blunt end of small RNA coding sequence is immediately downstream of lac promoter sequence. false Graham Heimberg annotation2372379 1 Original sequence of K252001 without R0010 range2372379 1 1 109 BBa_K252001_sequence 1 gttatatgcctttattgtcacagattttattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z